Mintbody Med Spa. We invite you to book a free consultation or contact us to get more details on how our Membership Programs work at MINTbody Spa & Wellness. As the binding affinity and residence time of Mintbodies are similar to those of Fabs. (281) 469-0033. 5 (11 reviews) MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. CEO Approval Rating - -/100. The result is noticeably smoother, healthier-looking skin that you'll be happy to show off. com MINTbody Med Spa & Wellness is Cypress’s first dedicated med-spa, designed to serve clients with the very best in beauty and personal enhancement. Hair Salon. offers a unique. The med spa: Certified laser technicians use a number of techniques to contour and smooth the body. 3%. Wellness and Aesthestices Care Center in Cypress, reviews by real people. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Specialties: We excel in customer service! Also specializing in Skin Care, Facials, Laser Treatments for all skin treatments and hair reduction as well as the best pedicures in. Get to us at MINTbody Med Spa & Wellness to book your appointment with us. See more reviews for this business. house located at 20319 Mountaindale Dr, Cypress, TX 77433 sold on Apr 25, 2022 after being listed at $190,000. Join the. Galleria Aesthetics Med Spa. Mintbody Med Spa. We thus. EMBO Rep. The H3K27me3 mintbody coupled to ER-mAID-Dam was knocked into the Rosa26 locus by co-transfection of pHom-ER-mAID-V5-Dam-scFv_H3K27me3-P2A-BSD-Hom donor vector and p225a-Rosa26 spCas9-RNA vector (sgRNA: gtccagtctttctagaagatgggc) as described above. 832-674-7006. MINTbody Spa & Wellness carries a variety of professional and medical grade skin care products that are top in the market. MLS# 45658132. FDA Approved technologies, Pain free treatment and Professional and certified Staff. Clinic 45. MINTbody Med Spa Fairfield details with ⭐ 24 reviews, 📞 phone number, 📍 location on map. These signs and symptoms may flare up for weeks to months and then will go away in timeOnce you register, you’ll start earning points each time you visit us for select treatments. Ideal Image Bunker Hill. Locations. Dermaplane es un método de exfoliación que consiste en usar un bisturí de calibre 10 para raspar suavemente la capa superior de las células muertas de la piel, y también el vello facial, dejando la superficie muy suave con un cutis más brillante. We are always striving to make MINTbody Med Spa and Wellness bigger and better. MINTbody Med Spa and Wellness is a Biote Certified Provider in Cypress, TX. Services include facials, microdermabrasion,. Mintbody Med Spa. 44 views, 0 likes, 0 loves, 0 comments, 0 shares, Facebook Watch Videos from MINTbody Spa & Wellness: Your Beauty, Our TouchFirst, a modification-specific intracellular antibody (mintbody) was observed. Website. MINT Team. Small Business Owner at MINTbody Med Spa & Wellness 2y Report this post love this . Ste 7000. Services include facials, microdermabrasion, body treatments, peels, laser hair removal. APN 1418810020005. Emsculpt Neo the only device on the market that has clinical studies showing 30% fat reduction and building 25% muscle in the abdomen. SOBRE. This procedure results in instant skin lifting. Nestled in Cypress, TX, our team of. Additionally, they noted that the RNAP2-Ser2ph-mintbody turned. Renati Med Spa. Three Microneedling treatments. 3,030 Sq. Nicest guy with great bed side manor. , 2015). Dos ubicaciones convenientes. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation. I'm sure this location will be equally amazing. Specialties: Milan Laser provides laser hair removal services with permanent results. Magnetic resonance imaging (MRI) is a technique that allows observation of specific molecules in living organisms. Second, the mintbody foci were observed depending on RNAP2 and. Suite 105. Medical Spas, IV Hydration, Body Contouring. Salary information comes from 1 data point collected directly from employees, users, and past and present job advertisements on Indeed in the past 24 months. The mintbody enrichment within such domains was measured and followed in individual cells throughout the length of the experiment (Fig 3C). Medical Spas, IV Hydration, Body Contouring. A PDO thread lift is a revolutionary new treatment in the world of aesthetics. 11. MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. It is performed by rubbing fine crystals into the skin using a device and takes about 30 minutes to perform. Health Spa. MINTbody Med Spa & Wellness was awarded "Best Medical Facial in Cypress!" Medifacials are facials done in a medical spa or a clinic by trained medical staff like the doctor, nurse or a technician. Open Now Open to All Accepts Credit Cards Offers Military Discount Free Wi-Fi Gender-neutral restrooms. Medical Spa. Obstetricians. •10+ years of team management. Nicholai Stephens. 11. Mintbody Med Spa. 2. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation services, including Laser Hair Removal treatments, Body Contouring, Skin Tightening,. 34. This is the combination of cosmetic procedures used to restore your facial features. 1. Surgical methods of vaginal rejuvenation typically involve sedation or anesthesia. MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. Each with 15+ years of experience, the MINTbody team includes a medical director, a nurse practitioner, a medical assistant, a client coordinator, and three medical aestheticians/laser techs whose mission is to serve clients. MINTbody Med Spa & Wellness 4. La Hair Garland. 9 miles away from Balle Bliss Luxury Medical Spa. Our Team will work to tailor a specific treatment package just for you. We offer a wide range of luxurious day spa services alongside non-invasive cutting edge treatments medically directed by. Amerejuve Inc. Family Practice, Urgent Care, Walk-in Clinics. Jump to. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read more3 beds, 2. Pure Barre (Cypress) Gym/Physical Fitness Center. The researchers saw that the RNAP2-Ser2ph-mintbody became diminished during cellular mitosis and in the presence of RNAP2 inhibitors. 34. All of this works together to give you enhanced skin texture, fewer fine lines, wrinkles and. 11. 1. 1. • Procedimiento más. The mintbody enrichment within such domains was measured and followed in individual cells throughout the length of the experiment (Fig 3C). You will not be disappointed at all the customer service is awesome . Scroll down to review symptoms of hormone imbalances for. 11. 11. “Finally found my favorite Med Spa. MINTbody Med Spa and Wellness offers treatments such as Laser / IPL therapy, Facial treatments and medical grade skin care products which can control and reduce symptoms. Medical Spas, IV Hydration, Body Contouring. No downtime. Beauty, Cosmetic & Personal Care. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read more. Kale MD | 132 followers on LinkedIn. 11. Our Team will work to tailor a specific treatment package just for you. 19. Mintbodies are genetically encoded probes with a single-chain variable fragment (scFv) fused to a fluorescent protein. Get Directions. . What services does your business offer and what makes your business stand out from the competition? MINTbody Med Spa and Wellness specializes in skin rejuvenation using the industry's cutting edge platforms to provide non-invasive aesthetic procedures: photofacial, acne treatment, laser hair removal, skin. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Ambriza Cypress. 13 $$ Moderate Medical Spas, Skin Care. I was very impressed with the warm welcome when I entered and the pleasant atmosphere. MINTbodt fue votado recientemente como el mejor spa médico de 2020, depilación láser y mejor tratamiento facial. OPEN TODAY, 5PM TO 7PM. By combining live-cell imaging of H3K27me3, H4K20me1, the X chromosome and Xist RNA, with ChIP-seq analysis we uncover concurrent accumulation of both marks during XCI, albeit with. Nearby homes similar to 19442 SERGEANT RANCH ST have recently sold between $415K to $550K at an average of $180 per square foot. We won in 3 categories last year and going for it again this year!! Best Medical Spa in Cy-Fair area Best Place for Facial Treatments Best Place for Laser…MINTbody Med Spa & Wellness. $250. They have amazing customer service and the treatments really works. Save up points or redeem them at checkout for discounts on the treatments and products you know and love. Medical Spas, Body Contouring, IV Hydration. MINTbody MedSpa is a combination of medical, day spa, and massage therapy services. 26 oct 2022, 16:30 – 19:30 GMT-5. Also builds butt, arms and legs. . To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. They differ from salon facials done by beauticians. The ferritin heavy chain (FTH1) is one of the MRI reporters used in mammals. Mintbody Med Spa. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation. Not now. Oriental Acupuncture & Herb Clinic. We offer a variety of treatments, such as injections of BOTOX® Cosmetic, Sculptra, Restylane® and JUVÉDERM® at our MINTbody Med Spa locations. 165 $$ Moderate Skin Care. 33 $$ Moderate Medical Spas, Skin Care, Laser Hair Removal. MINTbody Med Spa es la combinación perfecta de proveedor de servicios médicos, de spa diurno y de terapia de masajes. MINTbody Med Spa & Wellness opened a second location in September at 14131 Mueschke Road, Ste. Mintbody Med Spa. El Lifting de cuello no quirúrgico puede ayudar a mejorar el tono y la textura de la piel, reducir la apariencia de arrugas, pliegues del cuello y darle al contorno de su cuello un aspecto más juvenil. Cypress, 14131 Mueschke Rd Unit 203, Cypress, TX 77433, USAThrIVe Drip Spa is an IV Vitamin Infusion Therapy and lifestyle wellness spa in Houston, and the Rio Grande Valley in Texas, that has taken traditional medical treatments and given them a modern twist. Also, I. 18 $$$ Pricey Laser Hair Removal,. Contact us. Save. Led by board-certified dermatologist Samantha Robare, MD, Magnolia Dermatology offers a full selection of treatments for wrinkles, skin laxity, acne, and other everyday skin concerns. MINTbody MedSpa. Injection Bar Medspa and Wellness. The fat looks like a small pooch next to the armpit. Microdermabrasion is a less intense version of a dermabrasion. 832-674-7006. Log In. Avery has really worked her magic to help my skin…” more. 8350 Fry Rd. Beauty, Cosmetic & Personal Care. From various in vitro and in vivo analyses, we concluded that the H4K20me1-scFv and H4K20me1-mintbody retain the original IgG's specificity to H4K20me1. A PDO thread lift is a revolutionary new treatment in the world of aesthetics. 203, Cypress. As chromatin-unbound mintbodies can diffuse out to the cytoplasm, the nucleus/cytoplasm intensity ratio can be a measure of the. Best Medical Spas in Cypress, TX - Face to Face Spa at Towne Lake, Mintbody Med Spa, Aesthetica MD Med Spa - Cypress, Skin Therapy By Jo Jo, Basu Aesthetics + Plastic Surgery: C. Related Pages. Acné; Carreras; Contacto; Nuestro equipo; UbicacionesMintbody Med Spa. Log In. One Microneedling treatment. We can’t find the page you’re looking for. Not now. 12 $$ Moderate Skin Care, Laser Hair Removal, Medical Spas. Best Medical Spas in Cypress, TX 77429 - Mintbody Med Spa, Face to Face Spa at Towne Lake, Energe Spa, Nikko Dermatology, VV Med Esthetics, MD Advanced Skincare, Elaris Med Spa | Wellness | Clinic, Skin Therapy By Jo Jo, Aesthetica MD Med Spa - Cypress 23. Bob Basu, MD "I'm a mother of 2 little girls 3 and 1 1/2 and it left me with an excessive amount. in Psychiatrists. LaserAway. To generate a mintbody that can specifically bind to Ser2P, we cloned cDNA from the 42B3 hybridoma cell line for use as the. Proudly created by Hi End Media LLC. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Nita Med Spa. A full. To help put your mind and bodyStop looking for spa packages near me and visit the best spa center near me where you can have best med spa at highly reasonable rates. 72 $$ Moderate Medical Spas, Laser Hair Removal. Vaginal Rejuvenation: utilizes laser technology to treat symptoms associated with painful intercourse, vaginal dryness, recurring. MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. Established in 2012. for a Free Consultation. We offer a variety of treatments, such as injections of BOTOX® Cosmetic, Sculptra, Restylane® and JUVÉDERM® at our. Self starter, visionary and a leader. Medical Spas, IV Hydration, Body Contouring. MINTbody Med Spa and Wellness ofrece igualdad de oportunidades de empleo (EEO) a todos los empleados y solicitantes de empleo sin distinción de raza, color, religión, sexo, nacionalidad, edad, discapacidad o genética. Not now. Elaris Med Spa | Wellness | Clinic. Mintbody Med Spa. Medical Spas, IV Hydration, Body Contouring. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read more 8 reviews of Ultimate Drip Therapy and Wellness "I enjoyed my first experience here. FDA Approved technologies, Pain free treatment and Professional and certified Staff. These signs and symptoms may flare up for weeks to months and then will go away in timeOnce you register, you’ll start earning points each time you visit us for select treatments. La grasa a veces se acumula en esa área a medida que envejece, pero incluso los hombres y mujeres más jóvenes pueden estar genéticamente predispuestos a. MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. H4K20me1-mintbody is concentrated on inactive X chromosomes . Mount Royal University. Although she has over 16 years of experience practicing Emergency Medicine, she has. 235 views, 4 likes, 0 loves, 0 comments, 0 shares, Facebook Watch Videos from MINTbody Spa & Wellness: Dynamic Cupping inserts movement and massage into cupping therapy. I. Get Directions. . Medical Spas, Body Contouring, IV Hydration. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. MINTbody Med Spa is the perfect combination of Medical, Day Spa and IV Therapy Bar service provider. Some common surgical procedures for vaginal rejuvenation are: Labiaplasty: Reshaping your labia or the “lips” of your vagina. Not now. We are all about helping. El resultado es una piel notablemente más suave y de aspecto más saludable que le encantará lucir. MINTbody Med Spa & Wellness Voted Best Medical Spa for Four Years in a row Book Your FREE Consultation today (832) 674-7006 Your Beauty, Our Touch! Laser Hair Removal destroys hair follicles, leaving you with. " To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Accessibility Help. 8 (34 reviews) Medical Spas Body Contouring IV Hydration. SOBRE. Vaginoplasty: Tightens or repairs the vaginal canal after childbirth. El resultado es una piel notablemente más suave y de aspecto más saludable que le encantará lucir. Proudly created by Hi End Media LLC. MINTbody Med Spa and Wellness offers testosterone therapy. MINTbody Med Spa & Wellness is Cypress’s first dedicated med-spa, designed to serve clients with the very best in beauty and personal enhancement. offers a unique combination of age-defying medical treatments such as Body Contouring - cellulite reduction, skin rejuvenation services including Laser Hair Removal, Tattoo removal, Skin Tightening,. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation services, including Laser Hair Removal treatments, Body Contouring, Skin Tightening,. MINTbody Med Spa & Wellness Nov 2017 - Present 5 years 9 months. Selah Medi Spa. Toggle navigation FindCurrently there're 20 MINTbody Coupon Codes available on HotDeals. Clearstone Laser Hair Removal & Medical Spa grew from an. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Our Team will work to tailor a specific treatment package just for you. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read moreMintbody Med Spa. The benefit of the non-surgical rhinoplasty is the short downtime in the setting of a relatively painless procedure. m. 11. Ubicado en Cypress, TX, nuestro equipo de profesionales médicos capacitados brinda una gama completa de los servicios de rejuvenecimiento de la piel más avanzados y mínimamente invasivos, que incluyen tratamientos de depilación. 4. Spa Manager MD Skincare and Laser Oct 2015 - Nov 2017 2 years 2 months. 19. This is a placeholder. 11. Mintbody Med Spa. Algunos de los otros beneficios del lifting de cuello no quirúrgico son: . Contact us. Established in 2017, MINTbody Med Spa & Wellness is an advanced med. Our business specializes in skin rejuvenation using the industry's cutting edge platforms to provide non-invasive. Specialties: At Le Chloé Med Spa KatyTexas our #1 priority is. 5% Off Your Order. To communicate or ask something with the place, the Phone number is (832) 674-7006. Strati Georgopoulos Executive Search I Creating Social Impact I Impact Investor. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation. Our Houston surgeon's passion for advanced surgical care is matched only by. Contact us. Spa Manager MD Skincare and Laser Oct 2015 - Nov 2017 2 years 2 months. The mintbody enrichment within such domains was measured and followed in individual cells throughout the length of the experiment (Fig 3C). ¡Lea sobre el equipo que lo hace posible!Best IV Hydration in Tomball, TX 77375 - VitaDrip IV Therapy, Quench IV Studio - Houston, The IV Society, Mintbody Med Spa, ThrIVe Drip Spa Woodlands, Old Rugged Cross Healthcare, Luxe Beauty and Wellness, Drip Dynamics Mobile IV Vitamin Infusions, Bounce Hydration, Ultimate Drip Therapy and WellnessMINTbody Med Spa is the perfect combination of Medical, Day Spa and Massage Therapy service provider. 16106 Horseback Ct, Cypress, TX 77433. 6K views, 12 likes, 0 comments, 0 shares, Facebook Reels from MINTbody Med Spa & Wellness. Find similar beauty salons and spas in Texas on Nicelocal. El Lifting de cuello no quirúrgico puede ayudar a mejorar el tono y la textura de la piel, reducir la apariencia de arrugas, pliegues del cuello y darle al contorno de su cuello un aspecto más juvenil. Medical Spas, Body Contouring, IV Hydration. Our Team will work to tailor a specific treatment package just for you. MINTbody SPA A luxurious Medical and Day Spa experience in NW Houston, MINTbody facility is designed around the needs of our guests, featuring well-appointed serenity room for private check-in and recovery, premium amenities and refreshment as well as towel services. Get directions. As a leading wellness spa on Vancouver Island, we strive to create a better world and to educate our clients about the health benefits of the treatments that. Minx Med Spa. You can get more information from their website. 5 baths, 2267 sq. Bioidentical Hormone Replacement Therapy (BHRT) is a method of restoring the balance of your hormones and aiming to relieve these symptoms, using compounded hormones that are identical in structure to those your body naturally produces. 832-674-7006. 1,330 likes · 248 were here. Beauty Salon. Stores. Mount Royal University. Medical Spas, Body Contouring, IV Hydration. 19 reviews of Nikko Dermatology "Been a patient of Dr Nikko since 2005. Mexican Restaurant. Acné; Carreras; Contacto; Nuestro equipo; UbicacionesCheck Mintbody Med Spa in Cypress, TX, Fry Road on Cylex and find ☎ (832) 674-7. Sulcata Psychiatry: Stoni Johnston, APRN, MSN, PMHNP-BC in Houston, reviews by real people. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation services, including Laser Hair Removal treatments, Body Contouring, Skin Tightening, Skin. Zhen Fan and Dr. . Face to Face Spa at Towne Lake. 6%. 3. There is minimal downtime requiring three. Nuestro personal en MINTbody Med Spa and Wellness nos convierte en uno de los mejores spas médicos en Cypress, TX y sus alrededores. Giselle’s Body-sculpting & Anti Aging Spa, LLC. Transformation Tuesday We are focusing on the abdomen and flanks of this lovely lady with our Venus radio frequency technology. I want to make one more visit before I leave. Booking & Pricing. To Learn more about any of our treatments, send us a message by clicking the button below or Call us (832) 674-7006. CONTACT US (832) 674-7006. Tested and updated daily. Aesthetica MD Med Spa - Cypress. If you have any questions, please contact our office. 34. Of note, unlike H3K27me3-mintbody, H4K20me1-mintbody shows increased nuclear signal during G2/M phase of the cell cycle, thus tracking the oscillations in H4K20me1 levels (Sato et al, 2016). It is perfect for those suffering from acne, uneven skin texture or skin tone, fine lines and wrinkles, acne scarring, sagging skin, age or sun spots, enlarged pores or hyperpigmentation. We use silicone cups in order. Specialties: Our office specializes in treatments to make you feel beautiful and healthy from the inside out- hormone balancing, weight management, autoimmune issues, facials, botox, microneedling treatments- we do it all! Established in 2016. Similar to mintbody, the probe associated with endogenous acetylated-histone tails and localized to the nucleus. . I feel pretty and look healthy. bottom of page. . . 69Best Medical Spas in Cypress, TX 77429 - Mintbody Med Spa, Face to Face Spa at Towne Lake, Energe Spa, Nikko Dermatology, VV Med Esthetics, MD Advanced Skincare, Elaris Med Spa | Wellness | Clinic, Skin Therapy By Jo Jo, Aesthetica MD Med Spa - CypressSpecialties: We focus on emotional, mental and physical well-being. 1. MINTbody Med Spa Fairfield located at 14131 Mueschke Rd Unit 203, Cypress, TX 77433 - reviews, ratings, hours, phone number, directions, and more. 9g-j), suggesting that the presence of the mintbody does not block Ser5. Los suplementos y multivitaminas orales se descomponen en el sistema digestivo y los nutrientes clave se pueden perder, pero ese no es el caso cuando recibe. Este tratamiento puede ser un gran complemento para cualquier tratamiento facial. Led by board-certified dermatologist Samantha Robare, MD, Magnolia Dermatology offers a full selection of treatments for wrinkles, skin laxity, acne, and other everyday skin. At Phaze Laser Med Spa We Are Dedicated To Improving. MINTbody Spa & Wellness is perfect combination of Medical and Day Spa service. Certified professionals. Nutraceuticals: Yes. See more of MINTbody Spa & Wellness on Facebook. MINTbody Med Spa and Wellness: Hair Salon: Images Hair Studio: Health Club/Gym: Armour Fitness: Laser Hair Removal: MINTbody Med Spa and Wellness: Local Weight Loss Program: Blades Wellness and Aesthetics: Manicure/Pedicure: Island Nail Lounge: Medspa: MINTbody Med Spa and Wellness: Pilates Class: The Pilates Firm:Mintbody Med Spa. Sections of this page. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read moreMINTbody Medical Spa and Wellness is an upscale medical and day spa, a first of its kind in the Cypress, TX area. This procedure is commonly performed at MINTbody Med Spa to treat minor to moderate concerns of the nose. Previously, Taif was a Cus tomer Account Executive at GuestTek. MINTbody Med Spa & Wellness - Fairfield 14131 Mueschke Suite 203 Dramatic changes in H3K9ac-mintbody localization during Drosophila embryogenesis could highlight enhanced acetylation at the start of zygotic transcription around mitotic cycle 7. Balle Bliss Luxury Medical Spa - 13611 Skinner Rd #270, Cypress. All. Specialties: We offer female rejuvenation, acne treatments,!medical weight loss, diagnostic labs, medical grade facials and chemical peels, laser hair removal, Emsculpt, Coolsculpting, IV therapy. 19219 Spotted Bass Ln, Cypress, TX 77433. Nuestro equipo trabajará para diseñar un paquete de tratamiento específico solo para usted. 34. We are a group of dedicated and caring health professionals in Vancouver devoted to helping you be your healthiest. Click to schedule an appointment. MINTbody Med Spa is the perfect combination of Medical and Day Spa service provider. Best Pros in Cypress, Texas. 34. With that in mind, we incorporate healthy product alternatives, along with fresh fruits and. Log In. I have had several facials with Avery and also a microneedling treatment. . MINTbody Spa & Wellness offers gift cards for your convenience that can be redeemed towards any of our services and skin care products. One of the best Medical Spas, Wellness business at 8350 Fry Rd #1000, Cypress TX, 77433 United States. The clinic has a licensed. Nestled in Cypress, TX, our team of medical trained professionals provide a full array of the most advanced, minimally invasive skin rejuvenation… read more8 Faves for MINTbody Med Spa Fairfield from neighbors in Cypress, TX. CHRISTINA KERN, MSN, APRN, FNP-C in Hockley, reviews by real people. Very knowledgeable and tentative. Taif Alhashmy's Phone Number and Email. Hidden Beauty Cosmetics By Amanda. MINTbody Med Spa provides the best facials treatments in Cypress & Houston, TX.